Journal: Traffic (Copenhagen, Denmark)

Article Title: Biochemical Characterization of APPL Endosomes: The Role of Annexin A2 in APPL Membrane Recruitment

doi: 10.1111/j.1600-0854.2011.01226.x

Figure Lengend Snippet: A) PNS extracted from S-HeLa cells was adjusted to the final OptiPrep concentration, 40.6% (w/v), and underloaded at the bottom of a 5–20% (w/v) continuous OptiPrep gradient. After centrifugation, 27 fractions of equal volume (450 µL each) were collected, pelleted, resolved on the gradient (6–15%) SDS–PAGE and immunoblotted for APPL2 and Annexin A2. B) Western blot shown in A was subjected to densitometric analysis with Odyssey Infrared Imaging System. Fluorescence intensities of APPL2 and Annexin A2 bands in each fraction are expressed in arbitrary units (AU). C and D) Colocalization analysis of APPL2 and Annexin A2 in CCD-1070SK cells. In (C), cells were fixed, permeabilized and immunostained with antibodies against APPL2 (red) and Annexin A2 (HH7 clone; green). In (D), cells were initially permeabilized as described in Materials and Methods in order to wash away the cytoplasmic fraction of Annexin A2, then fixed and immunostained as in D. Single confocal sections are shown in (C) and (D). Scale bar, 20 µm.

Article Snippet: To obtain pGEX-AnnexinA2, Annexin A2 open reading frame (ORF) (clone IRALp962P0840Q obtained from http://www.imagenes-bio.de ) was subcloned to pGEX-6P-1 (GE Healthcare), using the following primers: forward TACGGATCCTCTACTGTTCAC, reverse TACCTCGAGTCAGTCATCTCC.

Techniques: Concentration Assay, Centrifugation, SDS Page, Western Blot, Imaging, Fluorescence

Journal: Traffic (Copenhagen, Denmark)

Article Title: Biochemical Characterization of APPL Endosomes: The Role of Annexin A2 in APPL Membrane Recruitment

doi: 10.1111/j.1600-0854.2011.01226.x

Figure Lengend Snippet: A and B) HEK293 cells were co-transfected with the plasmid encoding bacterial biotin-protein ligase (BirA) and one of the plasmids encoding GFP, APPL2 or APPL1 tagged with a BirA target sequence (pBT-GFP, pBT-APPL2, pBT-mycAPPL2 or pBT-mycAPPL1). Forty-eight hours after transfection, cells were lysed and affinity purification of APPL-interacting proteins was performed with streptavidine-conjugated magnetic beads. A) Binding of Annexin A2 to in vivo biotinylated APPL1 or APPL2 proteins is shown. Samples were resolved on 10% SDS–PAGE. Nitrocellulose membrane was stained with Ponceau S (lower panel) and immunoblotted for Annexin A2 (upper panel). B) Binding of Annexin A1 and Annexin A6 to in vivo biotinylated APPL1 or APPL2 proteins was tested. Samples were resolved on 10% SDS–PAGE and immunoblotted for Annexin A1 and Annexin A6, with Annexin A2 serving as a positive control. C) Migration of Annexins A1 and A6 in the OptiPrep density gradient. PNS sample adjusted to the final OptiPrep concentration 40.6% (w/v) was underloaded at the bottom of a 5–20% (w/v) continuous OptiPrep gradient. Twenty-five fractions of equal volume (500 µL each) were collected, pelleted, resolved on the gradient (6–15%) SDS–PAGE and immunoblotted for APPL2, Annexin A6, Annexin A1 and Annexin A2. D–F) GST pull-downs were performed with wild-type GST–Annexin A2 (GST–ANXA2) or GST alone with lysates from HEK293 cells overexpressing HA-APPL1 (D) and HA-APPL2 (E) or in vitro translated APPL2 (F). All samples were resolved on 8% SDS–PAGE and immunoblotted for APPL1 or APPL2, as indicated. As controls, 1 µL of cell lysates (1% of the input) was loaded in (D) and (E), and 1 µL in vitro translated protein (2% of the input) was loaded in F. G) GST pull-downs were performed with GST–Annexin A2 wild-type (GST–ANXA2) or mutants (TCM, Y23D, Y23A, CTΔ9, CTΔ13), or GST alone using lysates from HEK293 cells overexpressing HA-APPL2. All samples were resolved on 10% SDS–PAGE. Nitrocellulose membrane was stained with Ponceau S (lower panel) and immunoblotted for APPL2 (upper panel). As a control, 1 µL of cell lysate (1% of the input) was loaded. MW, lane with a molecular weight marker.

Article Snippet: To obtain pGEX-AnnexinA2, Annexin A2 open reading frame (ORF) (clone IRALp962P0840Q obtained from http://www.imagenes-bio.de ) was subcloned to pGEX-6P-1 (GE Healthcare), using the following primers: forward TACGGATCCTCTACTGTTCAC, reverse TACCTCGAGTCAGTCATCTCC.

Techniques: Transfection, Plasmid Preparation, Sequencing, Affinity Purification, Magnetic Beads, Binding Assay, In Vivo, SDS Page, Membrane, Staining, Positive Control, Migration, Concentration Assay, In Vitro, Control, Molecular Weight, Marker

Journal: Traffic (Copenhagen, Denmark)

Article Title: Biochemical Characterization of APPL Endosomes: The Role of Annexin A2 in APPL Membrane Recruitment

doi: 10.1111/j.1600-0854.2011.01226.x

Figure Lengend Snippet: A–D) CCD-1070SK cells were transfected with three different siRNAs targeting Annexin A2 (AnxA2 siRNA_1-3) or two non-targeting negative controls (nc1, nc2), or were mock transfected (nt). A) Ninety-six hours after transfection, cells were lysed and the level of Annexin A2 was assessed. Samples were resolved on 8% SDS–PAGE and immunoblotted for APPL2 and Annexin A2, with β-actin as a loading control. B) Cells were fixed and immunostained with antibodies against APPL2. Single confocal images are shown. Scale bar, 20 µm. C and D) Total integral fluorescence intensity of APPL2 vesicles (C) and their average number (D) were quantified using M otion T racking software. At least 20 images of each variant were subjected to the analysis. The data are representative of three independent experiments. Error bars are SEM (standard error of the mean), fluorescence intensity is expressed in arbitrary units (AU). E and F) CCD-1070SK cells were transfected with non-targeting negative siRNA control nc2 (E) or with siRNA AnxA2 siRNA_3 targeting Annexin A2 (F), fixed and immunostained with antibodies against Annexin A2 and endosomal markers EEA1, Rab5 or Rab11, as indicated. Scale bar, 20 µm.

Article Snippet: To obtain pGEX-AnnexinA2, Annexin A2 open reading frame (ORF) (clone IRALp962P0840Q obtained from http://www.imagenes-bio.de ) was subcloned to pGEX-6P-1 (GE Healthcare), using the following primers: forward TACGGATCCTCTACTGTTCAC, reverse TACCTCGAGTCAGTCATCTCC.

Techniques: Transfection, SDS Page, Control, Fluorescence, Software, Variant Assay

Journal: Traffic (Copenhagen, Denmark)

Article Title: Biochemical Characterization of APPL Endosomes: The Role of Annexin A2 in APPL Membrane Recruitment

doi: 10.1111/j.1600-0854.2011.01226.x

Figure Lengend Snippet: CCD-1070SK cells were transfected with plasmids encoding Annexin A2–GFP, myc-tagged Rab5-S34N or both, as indicated. Cells were fixed and immunostained with antibodies against APPL2 (green), GFP (red) and myc (blue). Single confocal sections are shown. Scale bar, 20 µm.

Article Snippet: To obtain pGEX-AnnexinA2, Annexin A2 open reading frame (ORF) (clone IRALp962P0840Q obtained from http://www.imagenes-bio.de ) was subcloned to pGEX-6P-1 (GE Healthcare), using the following primers: forward TACGGATCCTCTACTGTTCAC, reverse TACCTCGAGTCAGTCATCTCC.

Techniques: Transfection

Journal: bioRxiv

Article Title: Functional characterization of putative ecdysone transporters in lepidopteran pests

doi: 10.1101/2022.04.20.488866

Figure Lengend Snippet: (A) Subcellular localization of SfOATP74D and HaOATP74D tagged with V5 epitope in transiently transfected Sf-9 cells. Blue indicates DAPI that counterstains nuclei, while Red indicates anti-V5, scale bar 20μM. (B) Luciferase assay in HzAW1WT and HzAW1ΔOATP74D cell lines after treatment with 0.1μΜ and 1μΜ 20-HE post transfection with the ecdysone responsive luciferase contruct. Asterisks indicate statistically significant differences between the treated and the untreated groups calculated with one-way ANOVA and post-Dunnet’s test, ****p<0.0001. (C) Inhibition analysis of lepidoptera OATP74D by Telmisartan in stable cell lines. The cell lines were incubated with 0.1uM of 20-HE in the presence of serial concentrations of Rifampicin (1.25μΜ, 2.5μΜ and 5μΜ) or DMSO (negative control). Each group is represented by eight different technical replicates. Asterisks indicate statistical significance between the different conditions versus treated only with 20-HE calculated with one-way ANOVA followed by post- hoc Dunnett test, *p<0.048, ***p<0.0008. ns: non-significant

Article Snippet: The HaOatp74D (2136bp) ORF was synthesized de novo (Genscript, Piscataway, NJ) based on the alignment of both NCBI reference sequence and the de novo transcriptome assembly of H. armigera [ ].

Techniques: Transfection, Luciferase, Inhibition, Stable Transfection, Incubation, Negative Control

Journal: bioRxiv

Article Title: Functional characterization of putative ecdysone transporters in lepidopteran pests

doi: 10.1101/2022.04.20.488866

Figure Lengend Snippet: (A) Subcellular localization of SfOATP74D and HaOATP74D tagged with V5 epitope in transiently transfected HzAW1 cells. Blue indicates DAPI that counterstains nuclei, while Red indicates anti-V5, scale bar 20μM. (B) Western blot analysis of SfOATP74D-V5 and HaOATP74D-V5 in HzAW1 stable cell lines. Empty vector stable cells were used as negative control. Top panels represent blots HaOATP74D-V5 (left) and SfOATP74D-V5 (right) along with empty vector stably transfected cells using anti-V5. Bottom panel represent beta-tubulin used as loading control (∼55kDa). (C) Scematic representation of luciferase assay in stable cell lines expressing OATP74D orthologs. (D) Analysis of ecdysone induced luciferase expression in stable cell lines over-expressing SfOatp74D, HaOatp74D, DmOatp74D and HaOatp74D-V5, upon treatment with 0.1 and 1uM of 20-HE for 24hrs. Values are calculated as ratio of Relative luminescence units (RLUs) against the total protein content. Asterisks indicate statistical significant differences between cells overexpressing lepidoptera OATP74D against empty vector, *p=0.0149, ***p=0.0004, ****p<0.0001, calculated with one-way ANOVA followed by post-hoc Dunnett test, ns: non-significant.

Article Snippet: The HaOatp74D (2136bp) ORF was synthesized de novo (Genscript, Piscataway, NJ) based on the alignment of both NCBI reference sequence and the de novo transcriptome assembly of H. armigera [ ].

Techniques: Transfection, Western Blot, Stable Transfection, Plasmid Preparation, Negative Control, Control, Luciferase, Expressing

Journal: Annals of Laboratory Medicine

Article Title: Development of Enzyme-Linked Immunosorbent Assays Using 2 Truncated ORF2 Proteins for Detection of IgG Antibodies Against Hepatitis E Virus

doi: 10.3343/alm.2014.34.2.118

Figure Lengend Snippet: Alignment of the nucleotide sequences of the codon-optimized truncated ORF2 gene and the original truncated ORF2 gene by CLC sequence viewer 6.5.3 (CLC bio, Aarhus, Denmark). Abbreviaition: ORF, open reading frame.

Article Snippet: The pBluescript II SK (+) vector carrying the optimized ORF2.1 gene (pBluescript II SK-ORF2.1) was digested by NdeI and XhoI restriction enzymes (New England BioLab, Ipswich, MA, USA).

Techniques: Sequencing

Journal: Annals of Laboratory Medicine

Article Title: Development of Enzyme-Linked Immunosorbent Assays Using 2 Truncated ORF2 Proteins for Detection of IgG Antibodies Against Hepatitis E Virus

doi: 10.3343/alm.2014.34.2.118

Figure Lengend Snippet: PCR amplification of ORF2.1 (amino acids 112-660) and ORF2.2 (amino acids 112-608) with T7 promoter and T7 terminator primers. Lanes 1 and 7, 1-kb DNA ladder (Vivantis, Selangor Darul Ehsan, Malaysia); Lanes 2 and 3, amplified ORF2.1 gene; Lanes 4-6, amplified ORF2.2 gene. Abbreviation: ORF, open reading frame.

Article Snippet: The pBluescript II SK (+) vector carrying the optimized ORF2.1 gene (pBluescript II SK-ORF2.1) was digested by NdeI and XhoI restriction enzymes (New England BioLab, Ipswich, MA, USA).

Techniques: Amplification

Journal: Annals of Laboratory Medicine

Article Title: Development of Enzyme-Linked Immunosorbent Assays Using 2 Truncated ORF2 Proteins for Detection of IgG Antibodies Against Hepatitis E Virus

doi: 10.3343/alm.2014.34.2.118

Figure Lengend Snippet: Proteins expressed using pET30a-ORF2.1 recombinant expression vector and pET30a-ORF2.2 recombinant expression vector in E. coli BL21 (DE3) competent cells. The expressed and purified proteins were analyzed by 10% SDS-PAGE and stained with Coomassie Brilliant Blue R250. The ORF2.1 and ORF2.2 proteins bands are visualized at approximately 60 and 55 kDa, respectively. Lanes 1-4, purified eluates of ORF2.2 protein from the Ni column; Lane 5, washing step; Lane 6, flow-through; Lane M, pre-stained protein ladder (Fermentas, Vilnius, Lithuania); Lane 7-12, purified eluates of ORF2.1 protein from the Ni column; Lane 13, washing step; Lane 14, flow-through. Abbreviations: ORF, open reading frame; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis.

Article Snippet: The pBluescript II SK (+) vector carrying the optimized ORF2.1 gene (pBluescript II SK-ORF2.1) was digested by NdeI and XhoI restriction enzymes (New England BioLab, Ipswich, MA, USA).

Techniques: Recombinant, Expressing, Plasmid Preparation, Purification, SDS Page, Staining, Polyacrylamide Gel Electrophoresis

Journal: Annals of Laboratory Medicine

Article Title: Development of Enzyme-Linked Immunosorbent Assays Using 2 Truncated ORF2 Proteins for Detection of IgG Antibodies Against Hepatitis E Virus

doi: 10.3343/alm.2014.34.2.118

Figure Lengend Snippet: Western blot analysis of the expressed and purified ORF2.1 and ORF2.2 protein in E. coli . (A) The ORF2.1 protein band is visualized at approximately 60 kDa. Lane 1, induction for 2 hr; Lane 2, induction for 4 hr; Lane 3, uninduced control; Lane 4, BL21 control; Lane M, pre-stained protein ladder (Cinagen, Tehran, Iran). (B) The ORF2 protein band is visualized at approximately 55 kDa. Lane M, pre-stained protein ladder (Cinagen, Tehran, Iran); Lane 1, uninduced control; Lane 2, induction for 4 hr; Lane 3, flow-through; Lane 4, wash; Lane 5-7, the first, the second, and the third eluates. Abbreviation: ORF, open reading frame.

Article Snippet: The pBluescript II SK (+) vector carrying the optimized ORF2.1 gene (pBluescript II SK-ORF2.1) was digested by NdeI and XhoI restriction enzymes (New England BioLab, Ipswich, MA, USA).

Techniques: Western Blot, Purification, Staining

Journal: Annals of Laboratory Medicine

Article Title: Development of Enzyme-Linked Immunosorbent Assays Using 2 Truncated ORF2 Proteins for Detection of IgG Antibodies Against Hepatitis E Virus

doi: 10.3343/alm.2014.34.2.118

Figure Lengend Snippet: Comparison of the immunoreactivities of the 2 in-house ELISAs and DIA.PRO HEV IgG ELISA kit. Data are expressed as OD values of the positive and negative serum samples. The cut-off value is indicated for each assay by a horizontal line (0.35 for the in-house ELISA based on ORF2.1, 0.4 for the in-house ELISA based on ORF2.2, and 0.37 for DIA.PRO HEV IgG ELISA kit). Abbreviations: ORF, open reading frame; OD, optical density.

Article Snippet: The pBluescript II SK (+) vector carrying the optimized ORF2.1 gene (pBluescript II SK-ORF2.1) was digested by NdeI and XhoI restriction enzymes (New England BioLab, Ipswich, MA, USA).

Techniques: Enzyme-linked Immunosorbent Assay